Odpowiedzi

2009-11-15T10:47:25+01:00
TTAGGCTACTGTCCATAAGACAGT

nukleotydy DNA:
A-ademina
T-tymina
C-cytozyna
G-guanina

nukleotydy RNA
A-ademina
U-uracyl
C-cytozyna
G-guanina
1 5 1
Najlepsza Odpowiedź!
2009-11-15T12:06:41+01:00
Nukleotydy DNA:adeninowy,guaninowy,cytozynowy,tyminowy
nukleotydy RNA:adeninowy,uracylowy,gueninowy,cytozynowy
AATCGGATGACAGGTATTCTGTCA

TTAGCCTACTGTCCATAAGACAGT
2 3 2