Odpowiedzi

Najlepsza Odpowiedź!
  • Użytkownik Zadane
2009-11-16T19:45:00+01:00
Restrykcyjne endonukleazy (enzymy restrykcyjne) ligazy DNA
ATGGCCATCGTAAATTGCGGATTACGGC
TACCGGTAGCATTTAACGCCTAATGCCG
Z wyjątkiem niewielkiej grupy wirusów zawierających RNA, materiałem genetycznym całego świata żywego jest kwas deoksyrybonukleinowy (DNA).
Są one zawarte w podwójnej nici kwasu DNA. Jeżeli jakieś białko jest potrzebne w komórce, to odpowiedni fragment nici DNA ulega rozplątaniu na dwie oddzielne nici.W pierwszym etapie na DNA jest syntezowany RNA. Proces ten nazywa się transkrypcją. Ten RNA nazywa się messengerRNA ( w skrócie mRNA)Sekwencje te są w dwóch niciach KOMPLEMENTARNE, tzn. tam, gdzie w jednej nici jest A, tam w drugiej jest T, a tam, gdzie w jednej nici jest G, to w drugiej jest C i na odwrót. Proces transkrypcji polega na przepisaniu informacji genetycznej z jednego kwasu nukleinowego (DNA) na drugi kwas nukleinowy (RNA).
1 5 1
2009-11-16T19:46:39+01:00
2009-11-16T22:00:55+01:00
Fragment DNA:

AGCTTTGCAAGGG
GATCCCATGGAAA

fragment RNA:

AGCUUUGGACCCCAGU