W cytoplazmie znajduje się mRNA o następującej sekwencji nukleotydów
AUGACAAAAGGUGGCUGGUUC
a) zapisz sekwencje nukleotydów w dwuniciowym fragmencie DNA w którym zaszedł proces transkrypcji podanego odcinka mRNA
b)podaj z ilu aminokwasów będzie zbudowany łańcuch peptydowy powstały w wyniku translacji tego fragmentu mRNA

2

Odpowiedzi

2009-11-24T19:46:21+01:00
A)
TACTGTTTTCCACCGACCAAG

b) w wyniku translacji powstanie lancuch o dlugosci 7 aminokwasow
2009-11-24T20:45:24+01:00
A) TAC TGT TTT CCA CCG ACC AAG
b) jeden aminokwas jest kodowany przez 3 nukleotydy
nukleotydów jest 21 a wiec aminokwasów 21/3= 7
7 aminokwasów