Fragment łancucha DNA o sekwencji nukleotydów : A"T"CTAACGTGGCGTAAGCTGCTGCG
uległ mutacji, ktora polegala na wycieciu (utracie) jednego nukleotydu. Był to nukleotyd z tyminą, drugi w kolejnosci w zapisanym wyzej łancuchu ( zaznaczony "T" )
A) Korzystajac z tabeli kodu genetycznego ,zapisz sekwencje aminokwasow w peptydzie, ktory powstal w wyniku odczytania nici DNA przed mutacja
B) Zapisz sekwencje aminokwasow w peptydzie , ktory powstal w wyniku odczytania nici DNA po mutacji
C) Porownaj oba peptydy i wyciagnij wnioski

Zadanie 7 str. 45 Biologia 2 zakres podstawowy dla Liceum i Technikum

1

Odpowiedzi

2009-12-04T15:27:17+01:00
A) DNA ATC TAA CGT GGC GTA AGC TGC TGC G
mRNA UAG AUU GCA CCG CAU UCG ACG ACG C
bialko STOP-izoleucyna-alanina-prolina-histydyna-seryna- treonona-treonina

b) DNA ACT AAC GTG GCG TAA GCT GCT GCG
mRNA UGA UUG CAC CGC AUU CGA CGA CGC
bialko STOP-leucyna-histydyna-arganina-izoleucyna-arginina- arginina-arginina
4 4 4