1. Dopisz nić DNA komplementarną do zapisanej poniżej;
ATTACGGACCCAGTACGATTCGGAATACG

2. Korzystając z podręcznika, zapisz w odpowiedniej kolejności nukleotydy mRNA, a następnie DNA, na których podstawie powstał poniższy fragment białka zbudowany z 6 aminokwasów.

1

Odpowiedzi

Najlepsza Odpowiedź!
2009-12-23T16:32:53+01:00