Proszę o rozwiązanie.

Zadanie1.
Scharakteryzuj pojęcie Mitoza.

Zadanie2.
Wyjaśnij, jakie cząsteczki DNA, ile i dlaczego powstają w wyniku replikacji cząsteczki macierzystej.

Zadanie3.
Opisz krótko budowę cząstki DNA.

Zadanie4.
Uzupełnij zdania.
Informacja genetyczna zapisana w DNA dotyczy....................................................................................... Gen jest to.......................................................................................

Zadanie 5.
Wyjaśnij, na czym polega różnica między pojęciami materiał genetyczny i kod genetyczny.

Zadanie6.
Dopisz odpowiednie zasady azotowe w drugiej nici pokazanej poniżej cząsteczki DNA.
ACGCCTATTCGACCTTGGTACGACTGCACT
.................................................

Zadanie 7.
Uzupełnij zdanie.
Kariotypy jest to.......................................................................

Zadanie8.
Wymień rodzaje i funkcje plastydów.



3

Odpowiedzi

Najlepsza Odpowiedź!
2009-12-30T19:51:53+01:00
Zad 1.
Mitoza, kariokineza, podział jądra komórkowego (kariokinetyczny, pośredni), w trakcie którego chromosomy dzielą się wzdłuż na dwa chromosomy siostrzane, wskutek czego w jądrach potomnych znajdują się dwa (diploidalne), identyczne zespoły chromosomów zawierające identyczną informację genetyczną.

zad2
Replikacja DNA to proces, w którym podwójna nić DNA ulega skopiowaniu.

Replikacja (podwojenie) prowadzi do powstania dwóch komórek o takiej samej liczbiechromosomów co komórka macierzysta.

zad 3
DNa wyglądem przypomina spiralnie skręconą drabinę (jest to tak zwana podwójna helisa).Szczeble tej drabiny są zbudowane z połączonych odpowiednio zasad azotowych (zasada komplementarności)

DNA składa się z :
cukier deoksyryboza
reszta kwasu fosforowego.
- jedna z czterechzasad azotowych : adenina , tymina , guanina , cytozyna.

zad 4
a) budowy wszystkich białek.
b) fragment DNA zawierający informację genetyczną o produkcji jakiegoś białka.

zad 5
Materiał genetyczny-substancja chemiczna będąca nośnikiem informacji genetycznej. Inaczej mówiąc, materiał genetyczny jest fizycznym nośnikiem dziedziczności.

Kod genetyczny- reguła zapisu informacji genetycznej w DNA.

zad 6
ACGCCTATTCGACCTTGGTACGACTGCACT
TGCGGATAAGCTGGAACCATGCTGACGTGA

ZAD 7
Kariotyp -kompletny zestaw chromosomów komórki somatycznej organizmu.

zad 8
Plastydy dzielimy na:
bezbarwne, wytwarzane bez udziału światła, aktywne podczas procesów metabolicznych:
leukoplasty, których główną funkcją jest przechowywanie materiałów zapasowych, do których zaliczają się:
lipidoplasty, olejoplasty, elajoplasty (magazynujące tłuszcze)
amyloplasty (magazynujące węglowodany – w postaci ziaren skrobi, uczestniczące w zjawisku geotropizmu statolity)
proteoplasty, proteinoplasty (magazynujące białka – w postaci ziaren aleuronowych)
etioplasty, powstają z proplastów w etiolacji zawieraja protochlorofil
barwne, wytwarzane z udziałem światła:
aktywne w procesie fotosyntezy i innych procesach metabolicznych:
chloroplasty oraz inne rożnobarwne aktywne chromatofory, występujące w niektórych glonach, mające za zadanie produkowanie glukozy z wykorzystaniem energii świetlnej (fotosynteza)
nieaktywne podczas fotosyntezy i innych procesów metabolicznych
chromoplasty – zawierające barwnik czerwony karoten lub żółty ksantofil, czyli barwniki nadające barwę kwiatom, owocom, a czasem rówież korzeniom (np. marchwi)
21 3 21
2009-12-30T19:59:10+01:00
1Mitoza- jest podziałem powszechnie występującym, zachodzi we wszystkich komorkach somarycznych (soma= ciało),dzięki mitozie organizm rośnie,leczy rany.

2.RNA-kwas rybonukleinowy
rRNA- kwas rybosomowy
tRNA- kwas transportowy
mRNA- zawiera wiernie odpisaną informacje genetyczna z DNA jądrowego

3. DNA-pojedynczej jak i podwójnej nici, przy czym zazwyczaj DNA tworzy nić podwójną.DNA deoksyrybozy, zasady purynowej lub pirymidynowej przyłączonej do pierwszego atomu węgla pentozy, oraz reszty fosforanowej, przyłączonej do trzeciego oraz piątego atomu węgla dwóch sąsiednich pentoz polimeru.
Zasadami są lub tymina (w DNA).
Kwasy nukleinowe przechowują kod genetyczny organizmu oraz pośredniczą w produkcji białek.

4.Dotyczy .. budowy wszystkich bialek
Gen to Gen - fragment DNA nadający komórce zdolność do tworzenia jakiegoś RNA (różnych mRNA, tRNA, rRNA i in.), a pośrednio kodujący zwykle także jakieś białko (za pośrednictwem mRNA; mRNA określa budowę określonego białka, a tRNA i rRNA to cząsteczki pomocnicze uczestniczące w tworzeniu białek kodowanych w różnych mRNA; poszczególne rodzaje ogromnie zróżnicowanych cząsteczek mRNA zakodowane są w różnych genach).

5.Materiał genetyczny - substancja chemiczna będąca nośnikiem informacji genetycznej. Inaczej mówiąc, materiał genetyczny jest fizycznym nośnikiem dziedziczności. U wszystkich znanych organizmów żywych materiałem genetycznym jest DNA. U niektórych wirusów, np. u wirusa grypy lub wirusa HIV, funkcję tę pełni RNA.

Kod genetyczny to zespół reguł, według których informacja genetyczna jest zamieniana na sekwencję aminokwasów w białku. Od tej sekwencji zależą uchwytne, możliwe do sklasyfikowania i nazwania cechy organizmu.

6. PODANE: ACGCCTATTCGACCTTGGTACGACTGCACT
ODPOWIEDZ:TGCGGATAAGCTGGAACCATGCTGACGTGA

7. opisuje liczbe i ksztalt chromosomow

8. Plastydy
a) leukoplasty
-amynoplasty (gromadza cukry)
-proteinoplastyt (gromadza bialka)
-elajoplasty (gromadza tłuszcze)

b) chloroplasty
-chlorogil (zielony. głowny barwnik)
-afukoksantyna ( brunatny )
- fikoerytryna (czerwony)

c) chromoplasty
-karoten( barwnik pomaranczowy)
-ksantofil(żółty)
-antoncjan (fioletowy)
2 5 2
2009-12-30T20:03:13+01:00
Zad1 Mitoza – proces podziału pośredniego jądra komórkowego, któremu towarzyszy precyzyjne rozdzielenie chromosomów do dwóch komórek potomnych. W jego wyniku powstają komórki, które dysponują materiałem genetycznie identycznym z komórką macierzystą. Jest to najważniejsza z różnic między mitozą a mejozą. Mitoza zachodzi w komórkach somatycznych zwierząt oraz w komórkach somatycznych i generatywnych roślin.



zad 3---Budowa DNA-DNA jest makrocząsteczką zbudowaną z deoksyrybonukleotydów (w skrócie - nukleotydów). Są to związki kwasu fosforowego, pięciowęglowego cukru - deoksyrybozy i jednej z 4 rodzajów zasad azotowych A, G, C, T


zad4 Informacja genetyczna dotyczy budowy wszystkich białek. Gen to fragment DNA nadający komórce zdolność do tworzenia jakiegoś RNA


zad 5 Materiał genetyczny - substancja chemiczna będąca nośnikiem informacji genetycznej, a Kod genetyczny to reguła, według której informacja genetyczna, zawarta w sekwencji nukleotydów kwasu nukleinowego.


zad 6 TGCGGATAAGCTGGAACCATGCTGACGTGA

zad 7 Kariotyp to kompletny zestaw chromosomów komórki somatycznej organizmu


zad 8 chloroplasty- funkcje:
występują wyłącznie u organizmów roślinnych i niektórych protistów
mają zdolność pochłaniania energii słonecznej, z której w procesie fotosyntezy wytwarzają energię chemiczną.
-
leukoplasty-funkcja leukoplastów to gromadzenie substancji zapasowych, zazwyczaj skrobi, która tworzy się dzięki polimeryzacji glukozy doprowadzanej z części zielonych rośliny.

chromoplasty-


zad 2 nieumiem sorki


mam nadzieje że ci coś pomogłam ;)
1 4 1