1.Wyjaśnij dlaczego czasteczki białek nazywamy makroczasteczkami.


2.W cytoplaźmie znajduje się mRNA o następującej sekwencji nukleotydów : AUGACAAAAGGUGGCUGGUUC

a) zapisz sekwencję nukleotydów w dwuniciowym fragmencie DNA, na którym zaszedł proces transkrypcji podanego odcinka mRNA.

b)podaj, z ilu aminokawsów będzie zbudowany łańcuch peptydowy, powstały w wyniku translacji tego fragmentu mRNA

1

Odpowiedzi

Najlepsza Odpowiedź!
2010-01-05T19:51:25+01:00
1.Białka należą do najważniejszych składników pokarmowych, niezbędnych do utrzymania życia.
Białka są to makrocząsteczki o złożonej strukturze chemicznej, których elementarne części składowe stanowią aminokwasy, zbudowane z atomów węgla, tlenu, azotu, wodoru oraz siarki.
Atomy te tworzą proste związki noszące nazwę aminokwasów, które stanowią elementarne części składowe białek.
2.
a)
TACTGTTTTCCACCGACCAAG
b)
jeżeli nukteotydów jest 21 to aminokwasów jest 7 bo 21:3=7
1kodon=3nukleotydy=1aminokwas taki wzór
2 5 2