1.Dopisz komplementarna nic DNA do podanej
ATTATTCGTGGTACGTATATAGCCGTGATA
2.Dwuniciowy fragment DNA , zbudowany z 300 nukleotydów, zawiera 82 nukleotydy z tyminą . Oblicz ile nukleotydów z guaniną powinno być w tym fragmencie cząsteczki.

1

Odpowiedzi

Najlepsza Odpowiedź!
2009-09-22T19:38:32+02:00
ATTATTCGTGGTACGTATATAGCCGTGATA
TAATAAGCACCATGCATATATCGGCACTAT

Całość ma 300 nukleotydów
z czego 82 to tymina kolejne 82 to adenina
82+82=164nukleotydy
zostaje nam 136 nukleotydów
136/2=68
68 guaniny
68 cytozyny
odp :nukleotydów z guaniną powinno być 68

Pierwsze jest dobrze co do drugiego to nie jestem pewien
14 4 14