Proszę o krótkie, ale sensowne odpowiedzi
1. Informacja genetyczna zapisana w DNA dotyczy...
2. Funkcja DNA pełniona w komórce.
3. Wyjaśnij, na czym polega różnica między pojęciami materiał genetyczny i kod genetyczny.
4. Dopisz odpowiednie zasady azotowe w drugiej nici pokazanej poniżej cząsteczki DNA:
ACGCCTATTCGACCTTGGTACGACTGCACT

1

Odpowiedzi

2010-02-23T22:00:20+01:00
1. kolejności układu poszczególnych cech organizmu i zapisu aminokwasów w białku
2.stanowi zapis kolejności układu aminokwasów w białkach danej komórki, determinuje cechy organizmu
4.
ACGCCTATTCGACCTTGGTACGACTGCACT
TGCGGATAAGCTGGAACCATGCTGACGTGA