I.
1.Wyjaśnij na czym polega transkrypcja i wykonaj ją do podanego fragmentu łańcucha DNA:
DNA T A C T G T T T T C C A C C G A C C A A G. . . . .
2. Jak brzmi pierwsze prawo mendla? Podaj przykłąd krzyżówki.
II.
1.Na czym polega translacja w procesie biosyntezy białka? Wykonaj ją na poniższym przykładzie:
mRNA A U G A C A A A A G G U G G C U G G U U C
2. Mendel krzyżując kwiaty białe z czerwonymi, uzyskał w pierwszym pokoleniu(F1) wszystkie kwiaty czerwone. Następnie krzyżując je ze sobą( F1*F2) otrzymał oprócz czerwonych jeszcze białe?? dlaczego??
III.
1. Podaj z ilu aminokwasów będzie zbudowane białko powstałe z wyniku translacji poniższego fragmentu m RNA. ( Dlaczego)? Podaj nazwy tych aminokwasów.
2. Jak brzmi drugie prawo mendla? Jakie były jego podstawy?
IV.
1. Wyjaśnij na czym polega transkrypcja i wykonaj ją do podanego fragmentu łańcucha DNA:
DNA T A C G A G C A C T C T G G G T A C. . . .
2. Krzyżowano ze sobą osobniki homozygotyczne o czarnej barwie sierści( dominującej) z osobnikami homozygotycznymi o sierści białej. Podaj.
a) genotyp rodziców.
b) genotyp i fenotyp potomstwa ( F1 i F2)
V.
1. Na czym polega translacja w procesie biosyntezy białka? Wykonaj ją na poniższym przykładzie:
m RNA A U G C U C G T G A G A C C C A U G. . . . . .
2.Krzyżowano ze sobą kwiaty( homozygoty) o barwie czerwonej ( dominującej) z kwiatami( homozygoty) o barwie białej. Podaj
a) Genotyp rodziców.
b) Genotyp i fenotyp potomstwa ( F1 i F2)
VI.
1. Podaj z ilu aminokwasów będzie składał się polipeptyd powstały w wyniku translacji tego łańcucha m RNA (dlaczego) Podaj nazwy tych aminokwasów.
mRNA A U G C U C G T G A G A C C C A U G
2. Co to jest genotyp? Jak może być oznaczony? Jaki może mieć wpływ na fenotyp?
VII.
1. Dwuniciowy fragment DNA zbudowany z 300 nukleotydów zawiera 82 nukleotydy z tyminą. Oblicz ile nukleotydów z guaniną powinno być w tym fragmencie cząsteczki.
2. Jakie jest twoje stanowisko w sprawie produkcji żywnośći transgenicznej. Uzasadnij posługując się dwoma argumentami.

1

Odpowiedzi

Najlepsza Odpowiedź!
2010-03-11T23:24:27+01:00
I.
1. Transkrypcja polega na przepisaniu informacji o budowie białka z DNA na mRNA inaczej to tworzenie mRNA na matrycy DNA.
AUGACAAAAGGUGGUGGUUC
2. każda gameta wytwarzana przez organizm posiada tylko jeden allel z danej pary alleli genu.
np. P: AA x aa
G: A , A a , a
F1: Aa, Aa, Aa, Aa
II.
1. translacja to tłumaczenie języka nukleotydów na język białek, w wyniku tego procesu tworzone jest białko w rybosomach z aminokwasów
np. metionina, treonina lizyna, glicyna, glicyna, tryptofan, fenyloalanina

2. Dlatego że w pierwszej krzyżowce Mendel wziął czerwone, które były homozygotami dominującymi i skrzyżował z białymi homozygotami recesywnymi, a w drugim przypadku skrzyżował ze sobą dwie heterozygoty
III.
1. z 7 aminokwasów, ponieważ 3 kolejne nukleotydy na nici mRNA czyli 1 triplet lub 1 Kodon kodują 1 aminokwas (liczba kodonów - trójek nukleotydowych mRNA to się równa liczba aminokwasów), nazwy podałam Ci wyżej w punkcie II.

2. geny należące do jednej pary alleli są dziedziczone niezależnie od genów należących do innej pary.
Mendel zauważył że nasiona groch mogą być żółte lu zielone, gładkie lub pomarszczone i te 2 cechy dziedziczą się niezależnie od siebie.

IV.
1. na czym polega transkrypcja napisałam wcześniej
AUGCTCGUGAGACCCAUG
2. genoty rodziców: AA i aa
genotyp potomstwa F1 - 100% Aa, fenotyp 100% czarnej barwy sierści
genotyp potomstwa F2: 25% AA, 50% Aa i te będą czarnej barwy sierści oraz 25% aa i te będą mieć sierść białą.
V.
translację już wcześniej opisałam
teraz przykład Metionina Leucyna W TRZECIM KODONIE JEST BŁĄD!!!! - NIE MOŻE ON BYĆ GTG BO W mRNA nie ma T tylko U więc jeśli T ma być U to jest to kodon GUG czyli Walina potem jest Arginina, Prolina i Metionina
2. robisz tak samo jak tą krzyżówkę powyżej z kolorem sierści tam gdzie były czarne to w tej kwiaty mają czerwone, a tam gdzie były białe osobniki to teraz są białe kwiaty.

VI.
1. z 6 aminokwasów uzasadnienie takie samo jak w zad. III. 1.
czyli 1 triplet to 1 aminokwas.

Nazwy aminokwasów już podałam powyżej.

2. Genotyp to informacja o wszystkich genach danego organizmu, lub jest to układ alleli 1 lub kilku genów danego osobnika rozpatrywanych w konkretnym zadaniu.
Może byc oznaczony: AA homozygota dominująca, Aa heterozygota, aa homozygota recesywna
Fenotyp to zestaw cech osobnika powstały pod wpływem wyrażania się genotypu. Od genotypu zależy fenotyp.

VII.
1. T łączy się z A, G łączy się C
zatem jeśli jest 82 nukleotydy tyminowe to tyle samo musi być adeninowych czyli 82 razem to 164.
Wszystkich jest 300 to odejmujemy 164 i mamy 136.
136 to trzeba podzielić na 2 ( bo to liczba na którą składają się te z G i te z C) czyli 68 mamy nukleotydów z guaniną.
82 +82+68+68 =300

2. Stanowisko pozytywne: można w ten sposób otrzymać rośliny, które są odporniejsze na zmiany klimatyczne, można je dłużej magazynować bo szybko nie gniją ułatwia to ich transport na duże odległości (ważne w przypadku przewożenia owoców), są odporne na szkodniki (nie musimy już stosować środków chemicznych ochrony roślin), dają one większe plony, można też otrzymywać dzięki tym organizmom niektóre leki np. insulinę, hormon wzrostu, szczepionki.., zwierzęta transgeniczne np. krowy mogą produkować mleko bez składników uczulających człowieka...

Negatywne: Nie jesteśmy w stanie przewidzieć skutków spożywania takich organizmów na organizm ludzki gdyż za krótko się zajmujemy tą dziedziną nauki, ponadto modyfikowane organizmy są odporniejsze dlatego eliminują ze środowiska tzw. organizmy "dzikie" gorzej przystosowane w ten sposób zmniejsza się bioróżnorodność organizmów







6 2 6