1 Dopisz komplementarną nić DNA do podanej:
ATTATTCGTGGTACGTATATAGCCGTGATA.
2 Dwuniciowy fragment DNA, zbudowany z 300 nukleotydów, zawiera 82 nukłeolydy 7 lyminą. Oblicz, ile nukleolydów z guanina powinno być w tym fragmencie cząsteczki.
3. W DNA, otrzymanym z komórek nabłonkowych myszy, nuklcotydy z adeniną stanowią l 24% liczby wszystkich nukleotydów. Oblicz, ile procent w tyrn DNA stanowią nuklcotydy z cytozyną. Przedstaw i wyjaśnij sposób obliczenia

1

Odpowiedzi

2010-03-17T17:27:01+01:00
1 Dopisz komplementarną nić DNA do podanej:
ATTATTCGTGGTACGTATATAGCCGTGATA
TAATAAGCACCATGCATATATCGGCACTAT

2 Dwuniciowy fragment DNA, zbudowany z 300 nukleotydów, zawiera 82 nukłeolydy 7 lyminą. Oblicz, ile nukleolydów z guanina powinno być w tym fragmencie cząsteczki.
adenina odpowiada tyminie
więc jeżeli są 82 nukleotydy z tyminą, więc jest tyle samo z adeniną
tymina- 82
adenina- 82
guanina odpowiada cytozynie więc to samo
guanina+cytozyna- 300-82-82= 136
guanina- 136:2= 68
cytozyna- 68

Odp. W tym fragmencie cząsteczki powinno być 68 nukleotydów guaninowych.

3. W DNA, otrzymanym z komórek nabłonkowych myszy, nuklcotydy z adeniną stanowią 24% liczby wszystkich nukleotydów. Oblicz, ile procent w tyrn DNA stanowią nuklcotydy z cytozyną. Przedstaw i wyjaśnij sposób obliczenia

adenina odpowiada tyminie
więc to samo
ile adeniny = tyle tyminy
adenina- 24%
tymina- 24%
cytozyna+guanina- 100%-24%-24%= 52%
cytozyna- 52%:2= 26%
guanina- 26%

Odp. W tym DNA 26% stanowią nukleotydy z cytozyną.
3 3 3