Odpowiedzi

2010-03-27T11:02:51+01:00
Enzymy restrykcyjne - wyizolowane z bakterii enzymy, rozpoznające specyficzne sekwencje na nici DNA a następnie przecinające dwuniciową cząsteczkę DNA w ściśle określonym miejscu, znajdującym się w okolicy sekwencji rozpoznawanej.
Lepkie końce - komplementarne, jednoniciowe odcinki na końcach dwuniciowych cząsteczek DNA, zwykle powstałe przez przecięcie enzymami restrykcyjnymi.

ACGATCAGCTGGTACGCTGA
TGCTAGTCGACCATGCGACT to zakończenie tamtego kodu

ATTCGCAATGCTAGGCTAACGC
TAAGCGTTACGATCCGATTGCG A to nowy ;P

Mam nadzieje, że pomogłam.
6 4 6