1.Uzupełnij zapis nukleotydów w drugiej nici DNA. Przedstaw regułę, zgodnie z którą możesz to uzupełnić.
CCCAAAGGCGGATTA
……………………

2.Odszyfruj zakodowane w przedstawionym fragmencie DNA aminokwasy.
DNA: TACGGGACGCTGCATGGGGCT
mRNA: ……………………………………..
białko: ………………………………………………………………………………………………

1

Odpowiedzi

Najlepsza Odpowiedź!
2010-04-15T19:56:49+02:00
1. GGGTTTCCGCCTAAT
2 do tego nie mam pewności hmm
3 4 3