GCATGCGCTATGGCGAGGTTTGGTTTATCCAGAAAGCCCACTGCTGATC

1. Dokonaj replikacji podanej nici DNA.
2. Przedstaw nić mRNA utworzoną na bazie powstałego DNA.
3. Odszukaj kodon startowy i STOP.
4. Uzupełnij tabelę (w załączniku)

Poza tym, prosiłabym o wyjaśnienie czym jest replikacja, transkrypcja i translacja (ale jakoś tak jasno, na przykładzie jakimś może?)

2

Odpowiedzi

Najlepsza Odpowiedź!
2009-11-08T20:20:35+01:00
Replikacja - jest to kopiowanie nici DNA, na jednej matyrycowej nici, dobudowywana jest nić komplementarna.

transkrypcja - najprościej mówiąc jest to proces syntezy mRNA na matrycy DNA (jednym słowem, jest to przepisywanie informacji zawertej w DNA na matrycę RNA. jest to ważne, ponieważ DNA nie może "wyjść" z jądra komórki, a RNA może. mRNA potrzebne jest do syntezy białek)

translacja - jest to synteza białek na matrycy RNA.

1. Dokonaj replikacji podanej nici DNA.
GCATGCGCTATGGCGAGGTTTGGTTTATCCAGAAAGCCCACTGCTGATC
CGTACGCGATACCGCTCCAAACCAAATAGGTCTTTCGGGTGACGACTAG
2. Przedstaw nić mRNA utworzoną na bazie powstałego DNA.
GCATGCGCTATGGCGAGGTTTGGTTTATCCAGAAAGCCCACTGCTGATC
CGUACGCGAUACCGCUCCAAACCAAAUAGGUCUUUCGGGUGACGACUAG
3. Odszukaj kodon startowy i STOP.
kodon startowy - AUG (na DNA to ATG)
kodon stop - TGA
4. Uzupełnij tabelę (w załączniku)
58 3 58
2009-11-08T22:00:01+01:00
REPLIKACJA - (kopiowania DNA) synteza dna, podczas krórej z jednej czasteczki dna powstaja dwie identyczne (=replikacja semikonserwatywna):
masz 2 splątane nici z "kuleczkami" (zasadami azotowymi) które sa połaczone "patyczkami" (wiązaniamu wodorowymi. Kidy nici się rozplątuje to wiązania-patyczki pękaja, a kazka nić zabiera swoje zasady-kuleczki. aby powstało dna do każdej z nici dobudowywane sa nici z pasującymi (komplementarnymi) zasadami: w dna guanina(G) łaczy się z cytozyną C wiązaniem potrójnym, a tymina T z adeniną A wiązaniem podwójnym.

TRANSKRYPCJA - "przepisanie" informacji informacji genetycznej z jednego kwasu nukleinowego (DNA) an drugi (RNA):
DNA składa się z odcinkow kodujących białko (eksonów) i niekodującycjh (intronów). w procesie transkrypcji dochodzi do wycięcia intronów i powstaje prekursor RNA. Następnie zachodzi obróbka posttranskrypcyjna czyli splicing, eksony są sklejane ze sobą i to już jest mRNA

TRANSLACJA - proces zachodzący na rybosomach; odczytywanie informacji genetycznej czyli przetłumaczenie kolejności nukletydów na kolejność aminokwasów.
biorą tu udział cząsteczki tRNA (jakby transportującego rna), które zawierają antykodon ( czyli trójke nukleotydów komplementarnych do tych w mRNA, czyli kodujących dany aminokwas). jedna cząsteczka trna jest łaczona ze swoim aminokwasem - zawsze tym samym. a więc tak: rybosom składa się z podjednostki większej i mniejszej między które 'wchodzi' nić mRNA.w rybosomach mogą znajdować się jednoczęsnie tylko dwie czasteczki trna. proces zawsze zaczyna się od kodonu start w mrna, czyli AUG. do rybosomu przyłaczany jest tRNA z antykodonem (patrz tabelka lub zasada komplementarności w rna: guanina z cytozyna, adenina z uracylem - tyminy w rna nie ma). Powstaje aminokwas kodowany przez kodon AUG czyli METIONINA (patrz tabelka). następnie trna metioninowy odpada: w jego miejsce wchodzi drugi (w rybosomach mogą znajdować się jednoczęsnie tylko dwie czasteczki trna), a w miejse tego drugiego jakiś tam nowy. dajmy na to że następny trzy nukleotydy (kodon) w mrna to GAA. czyli przyłaczany jest rybosom z antykodonem CUU, powstaje aminokwas kodowany przez GAA, czyli GLUTAMINIAN. glutaminian łaczy się z metioniną, tworżąc początki białka. następnie trna glutaminianowy odpada, w jego miejsce wchodzi nowy itd. Proces kończy się gdy dochodzi się do kodonu stop dla którego już nie ma trna, nowo powstałe białko złozone z aminokwasów zostaje uwolnione i zachodzi nowy proces translacji

tabelka w załaczniku
27 4 27